Types | DnaRegion
|
Roles | polypeptide_domain
Protein_Domain
|
Sequences | BBa_K2184002_sequence (Version 1)
|
Description
1. The basic assumption of the project is based on the fact that there is a direct link between particular taste affection and the number of receptors for that taste. For this reason, the ability to control the polymorphism of taste receptors may be useful in many ways to human society
2. Guide RNA is a hundred base-long molecule with a unique two dimensional structure which binds Cas9 and guides it to a dsDNA sequence complementary to 21-22 base pairs on the 5' end of the molecule.
3. This molecule was specially designed to be able to identify SNPs in grapefroit flavor and mediate CRISPR editing of the non-taste allele only.
Notes
This molecule was specially designed to be able identify coffee biterness SNP and mediates CRISPR editing of the non-taste alleles only
Source
CACATCAGTGAGGAGATTCT