Types | DnaRegion
|
Roles | Protein_Domain
polypeptide_domain
|
Sequences | BBa_K2184003_sequence (Version 1)
|
Description
Identification of the selected allele for a specific taste receptor encoded and sliced in vitro using the Cas9 enzyme. This change will allow us to control and navigate the ability of the sense of taste as needed.
Cas9 is the endonuclease guided by the crRNA and tracrRNA (or trans-activating crRNA) to cleave specific DNA sequences. Binding specificity is based on the gRNA sequence and a three nucleotide NGG sequence called the protospacer adjacent motif (PAM) sequence.
Notes
This molecule was specially designed to be able to identify SNP in NaCl & Sour flavor and mediates CRISPR editing of the non-taste alleles only
Source
AGCTTTCATGACACACACGA