Types | DnaRegion
|
Roles | Protein_Domain
polypeptide_domain
|
Sequences | BBa_K2184004_sequence (Version 1)
|
Description
Guid RNA for cas9 for umami & monosodiom glutamat flavor-
The basic assumption of the project is based on the fact that there is a direct link between particular taste affection and the number of receptors for that taste. For this reason, the ability to control the polymorphism of taste receptors may be useful in many ways to human society, for example, specific desirable diet aid by reducing the ability to feel a specific unhealthy taste, reducing alcohol consumption by changing sensitivity to alcohol, reducing the risk of high blood pressure by eliminating the need for salt taste, changing the sensitivity for bitterness to allow swallowing a pill for the purpose of providing medical care and more.
Notes
This molecule was specially designed to able to identify umami & monosodiom glutamat SNP and mediates CRISPR editing of the non-taste alleles only
Source
CTACAACCGTGCCCGTGGCC