Source:
Generated By: https://synbiohub.org/public/igem/igem2sbol/1
Created by: iGEM2011 Potsdam_Bioware
Date created: 2011-09-19 11:00:00
Date modified: 2015-05-08 01:12:56
ABC transporter and N-acetyltransferase from mdn-cluster
| Types | DnaRegion |
| Roles | Coding CDS |
| Sequences | BBa_K627000_sequence (Version 1) |
Description
The BioBrick mdnED is a part of the whole microviridin gene (mdn) cluster, which encodes the protease inhibitor microviridin L. Microviridins are tricyclic depsipeptides, which are ribosomally synthesized by Microcystis (Ziemert et al., 2010). They have a promising potential for therapy as they can block disease-relevant proteases (Ziemert et al., 2008).Microviridins are synthesized from a ribosomal precursor peptide (MdnA). Additionally, the microviridin L biosynthesis gene cluster consists of genes encoding an ATP-grasp-type ligase (mdnB and mdnC) and genes, which encode an ABC transporter (mdnE) and a N-acetyltransferase of the GNAT family (mdnD) (Ziemert et al., 2008).
In the following BioBrick mdnED the genes mdnD (N-acetyltransferase of the GNAT family) and mdnE (ABC transporter) is encoded (Ziemert et al., 2008).
Because this BioBrick is an expression part, the adenin of mdnE gene's start codon is part of the XbaI recognition site.
Notes
This biobrick was built by PCR using the following PCR primersForward primer: TAAATGAATTCGCGGCCGCTTCTAGATGCCTCAATATACTACTAAAC
Reverse primer: ATTTCTGCAGCGGCCGCTACTAGTATCAGCAAACCCTACTTAATTTC
To insert mdnED in the vector pSb1C3, the resulting PCR product and the vector were digested with the restriction enzymes, EcoRI and SpeI.
Source
The BioBrick mdnDE as a part of the microviridin gene (mdn) cluster was isolated from Microcystis aeruginosa strain NIES-843.| Sequence Annotation | Location | Component / Role(s) |
| mdnE mdnD stop codon start codon stop codon start codon | 1,2063 2210,2743 2061,2063 2210,2212 2741,2743 1,2 | feature/cds CDS CDS feature/cds stop_codon feature/stop feature/start start_codon feature/stop stop_codon feature/start start_codon |