Source:
Generated By: https://synbiohub.org/public/igem/igem2sbol/1
Created by: iGEM11 Potsdam_Bioware
Date created: 2011-09-20 11:00:00
Date modified: 2015-05-08 01:12:56
ATP-grasp-type ligase from mdn-cluster
| Types | DnaRegion |
| Roles | CDS Coding |
| Sequences | BBa_K627002_sequence (Version 1) |
Description
The BioBrick mdnB is a part of the whole microviridin gene (mdn) cluster, which encodes the protease inhibitor microviridin L. Microviridins are tricyclic depsipeptides, which are ribosomally synthesized by Microcystis aeruginosa (Ziemert et al., 2010). They have a promising potential for therapy as they can block disease-relevant proteases (Ziemert et al., 2008).Microviridins are synthesized from a ribosomal precursor peptide (MdnA). Additionally, the microviridin L biosynthesis gene cluster consists of genes encoding an ATP-grasp-type ligase (mdnB and mdnC) and genes, which encode an ABC transporter (mdnE) and a N-acetyltransferase of the GNAT family (mdnD) (Ziemert et al., 2008).
The following BioBrick mdnB encodes a ATP-grasp-type ligase (Ziemert et al., 2008).
Because this BioBrick is a RFC10 expression part, the adenine of mdnB gene start codon is part of the XbaI recognition site.
Notes
This BioBrick was built by PCR using the following PCR primersForward primer: ATTATGAATTCGCGGCCGCTTCTAGATGAAAGAATCGCCTAAAGTTG
Reverse primer: TAATCTGCAGCGGCCGCTACTAGTATCAACCGAAGACTAAAAAATCAGCG
To insert mdnB in the vector pSB1C3, the resulting PCR product and the vector were digested with the restriction enzymes EcoRI and SpeI.
Because this BioBrick is a RFC10 expression part, the adenine of mdnB gene start codon is part of the XbaI recognition site.