Source:
Generated By: https://synbiohub.org/public/igem/igem2sbol/1
Created by: iGEM11 Potsdam_Bioware
Date created: 2011-09-20 11:00:00
Date modified: 2015-05-08 01:12:56
N-acetyltransferase from the mdn-cluster
| Types | DnaRegion |
| Roles | Coding CDS |
| Sequences | BBa_K627004_sequence (Version 1) |
Description
The BioBrick mdnD is a part of the whole microviridin gene (mdn) cluster, which encodes the proteaseinhibitor microviridin L. Microviridins are tricyclic depsipeptides, which are ribosomally synthesized
by Microcystis (Ziemert et al., 2010). They have a promising potential for therapy as they can block
disease-relevant proteases (Ziemert et al., 2008).
Microviridins are synthesized from a ribosomal precursor peptide (MdnA). Additionally, the microviridin L
biosynthesis gene cluster consists of genes encoding an ATP-grasp-type ligase (mdnB and mdnC) and genes,
which encode an ABC transporter (mdnE) and a N-acetyltransferase of the GNAT family (mdnD) (Ziemert et al.,
2008).
The following BioBrick mdnD encodes a N-acetyltransferase of the GNAT family (Ziemert et al., 2008).
Because this BioBrick is a RF10 expression part the adenine of mdnD gene's start codon is part of the XbaI
recognition site.
Notes
This BioBrick was built by PCR using the following PCR primersForward primer: TATATGAATTCGCGGCCGCTTCTAGATGAAAGCACTGGAAAAACTG
Reverse primer: ATTTCTGCAGCGGCCGCTACTAGTATCAGCAAACCCTACTTAATTTC
To insert mdnD in the vector pSB1C3, the resulting PCR product and the vector were digested with the restriction enzymes EcoRI and SpeI.
Because this BioBrick is a RF10 expression part the adenine of mdnD gene start codon is part of the XbaI recognition site.