| Types | DnaRegion
|
| Roles | RNA
mature_transcript_region
|
| Sequences | BBa_K635000_sequence (Version 1)
|
Description
This siRNA fragment is designed for modular inhibition of translation for various synthetic biology systems in yeast. The siRNA is reverse complementary to the biobrick kozak sequence BBa_J63003 and a randomly generated buffer sequence that should precede it GGAGTTGTGGGCACCTGCTA. The idea is similar to the RSID system developed by the Stanford 2010 iGEM team for siRNA control in E.coli.
Notes
The siRNA is intended to be a modular part that can be used in any circuit so long as the gene of interest is preceded by the corresponding random buffer region GGAGTTGTGGGCACCTGCTA and the kozak sequence BBa_J63003. The siRNA therefore was designed to be reverse complementary to the sequence mentioned above.
Source
This part is a novel sequence design. It is complementary to a unique buffer sequence and the kozak sequence (BBa_J63003.)