Source:
Generated By: https://synbiohub.org/public/igem/igem2sbol/1
Created by: Chang Ye
Date created: 2012-09-23 11:00:00
Date modified: 2015-05-08 01:13:25
iciA-inhibitor of chromosomal initiation of replication
| Types | DnaRegion |
| Roles | Coding CDS |
| Sequences | BBa_K806001_sequence (Version 1) |
Description
We find a better way to slow down the cell cycle of E.coli,by stop the initiation of DNA replication.iciA is ???the gene encoding the protein that binds the three 13-mers in the origin (oriC) of Escherichia coli to block initiation of replication in vitro???
we cloned and overexpressed it to slow down certain kind of cells in a mix quorum system, in order to maintain a more stable system and achieve better energy partition.
Notes
1. Add restriction enzyme in the front term of PCR primers2. Using genomic DNA extraction as a template of PCR we have better effect
Source
We clone this gene from E.coli strain BL21 with primer iciA-F and iciA-RiciA-F sequence:GCTCTAGAGCATGAAACGCCCGGACTACAGAAC
iciA-R sequence:GGACTAGTCCTTAATCCTGACGAAGGACTTTGTGAC
iciA sequence:(GenBank: CP001509.3)
1 atgaaacgcc cggactacag aacattacag gcactggatg cggtgatacg tgaacgagga
61 tttgagcgcg cggcacaaaa gctgtgcatt acacaatcag ccgtctcaca gcgcattaag
121 caactggaaa atatgttcgg gcagccgctg ttggtgcgta ccgtaccgcc gcgcccgacg
181 gaacaagggc aaaaactgct ggcactgctg cgccaggtgg agttgctgga agaagagtgg
241 ctgggcgatg aacaaaccgg ttcgactccg ctgctgcttt cactggcggt caacgccgac
301 agtctggcga cgtggttgct tcctgcactg gctcctgtgt tggctgattc gcctatccgc
361 ctcaacttgc aggtagaaga tgaaacccgc actcaggaac gtctgcgccg cggcgaagtg
421 gtcggcgcgg tgagtattca acatcaggcg ctgccgagtt gtcttgtcga taaacttggt
481 gcgctcgact atctgttcgt cagctcaaaa ccctttgccg aaaaatattt ccctaacggc
541 gtaacgcgtt cggcattact gaaagcgcca gtggtcgcgt ttgaccatct tgacgatatg
601 caccaggcct ttttgcagca aaacttcgat ctgcctccag gcagcgtgcc ctgccatatc
661 gttaattctt cagaagcgtt cgtacaactt gctcgccagg gcaccacctg ctgtatgatc
721 ccgcacctgc aaatcgagaa agagctggcc agcggtgaac tgattgactt aacgcctggg
781 ctatttcaac gacggatgct ctactggcac cgctttgctc ctgaaagccg catgatgcgt
841 aaagtcactg atgcgttact cgattatggt cacaaagtcc ttcgtcagga ttaa