Source:
Generated By: https://synbiohub.org/public/igem/igem2sbol/1
Created by: Abiel Trevi??o Garza
Date created: 2012-09-23 11:00:00
Date modified: 2015-05-08 01:13:34
A3 Promoter phage ϕ
(phi)29
| Types | DnaRegion |
| Roles | Regulatory promoter |
| Sequences | BBa_K851000_sequence (Version 1) |
Description
A3A3 is a promoter that comes from the Bacillus subtilis phage ϕ(phi)29 [1]. Bacteriophage ϕ29 protein p4 functions as transcriptional activator for A3 promoter.
BIOLOGY
A3 plays a major role in the transcriptional switch that divides bacteriophage ϕ29 infection in early and late phases [2, 3, 4, 5, 6]. A3 is the only late promoter of the ϕ29 viral particle and its transcript terminates at terminator TD1.
In vitro, protein p4 activates transcription from the late promoter A3 by stabilizing σ^A-RNAP at the promoter [7, 8]. In vivo, the synthesis of p4 is required for the activation of late promoter A3 and for the repression of early promoters A2b and A2c [9,10].
For iGEM UNAM Genomics M??xico 2012 project [11], A3 was used in the design of an OR logic gate[12] using a recently described new type of communication system between Bacillus Subtilis cells called Nanotubes[13].
A3 was obtained from pFRC54 plasmid reported in [14] as described in [15].
Notes
Primers usedUPPER 5'-3'
PREFIX+A3
5' GTTTCTTCGAATTCGCGGCCGCTTCTAGAG taactttttgcaaga 3'
LOWER 5'-3'
SUFIX+A3
5'GTTTCTTCCTGCAGCGGCCGCTACTAGTA ctacttaattatacc 3'
Source
REFERENCES[1] http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?lvl=0&id=10756
[2] Camacho A & Salas M (2010) DNA bending and looping in the transcriptional control of bacteriophage ϕ29. FEMS Microbiol Rev. 34(5):828-841.
[3] Sogo JM, Inciarte MR, Corral J, Vi??uela E & Salas M(1979) RNA polymerase binding sites and transcription map of the DNA of Bacillus subtilis phage ϕ29. J Mol Biol 127: 411???436.
[4] Barthelemy I, Salas M & Mellado RP (1986) In vivo transcription of bacteriophage ϕ29 DNA: transcription initiation sites. J Virol 60: 874???879.
[5] Mellado RP, Barthelemy I & Salas M (1986a) In vitro transcription of bacteriophage ϕ29 DNA. Correlation between in vitro and in vivo promoters. Nucleic Acids Res 14:
4731???4741.
[6] Mellado RP, Barthelemy I & SalasM(1986b) In vivo transcription of bacteriophage ϕ29 DNA early and late promoter sequences. J Mol Biol 191: 191???197.
[7] Barthelemy I & Salas M (1989) Characterization of a new prokaryotic transcriptional activator and its DNA recognition site. J Mol Biol 208: 225???232.
[8] Nuez B, Rojo F & SalasM(1992) Phage ϕ29 regulatory protein p4 stabilizes the binding of the RNA polymerase to the late promoter in a process involving direct protein???protein contact. P Natl Acad Sci USA 89: 11401???11405.
[9] Monsalve M, Menc??a M, Rojo F & Salas M (1995) Transcription regulation in Bacillus subtilis phage ϕ29: expression of the viral promoters throughout the infection cycle. Virology 207: 23???31.
[10] Nuez B, Rojo F & SalasM(1992) Phage ϕ29 regulatory protein p4 stabilizes the binding of the RNA polymerase to the late promoter in a process involving direct protein???protein contact. P Natl Acad Sci USA 89: 11401???11405.
[11] http://2012.igem.org/Team:UNAM_Genomics_Mexico
[12] http://2012.igem.org/Team:UNAM_Genomics_Mexico/Project/Description
[13] Dubey GP, Ben-Yehuda S. (2011) Intercellular nanotubes mediate bacterial communication. Cell.;144(4) :590-600
[14] Rojo F, Zaballos A & Salas M (1990) Bend induced by the phage ϕ29 transcriptional activator in the viral late promoter is required for activation. J Mol Biol 211: 713???725.
[15] http://2012.igem.org/Team:UNAM_Genomics_Mexico/Notebook/ANDMetal
| Sequence Annotation | Location | Component / Role(s) |
| p4 recognition site 1 p4 recognition site 2 Critical Recognition nucleotide Critical recognition nucleotide -10 | 1,31 33,64 3,3 29,29 86,91 | non_covalent_binding_site feature/binding non_covalent_binding_site feature/binding feature/misc sequence_feature sequence_feature feature/misc non_covalent_binding_site feature/binding |