BBa_M10090

BBa_M10090 Version 1

Component

Source:
http://parts.igem.org/Part:BBa_M10090
Generated By: https://synbiohub.org/public/igem/igem2sbol/1
Created by: Douglas Densmore
Date created: 2009-05-03 11:00:00
Date modified: 2015-05-08 01:13:51


Chal˃
}



Types
DnaRegion

Roles
sequence_feature

Other

Sequences BBa_M10090_sequence (Version 1)

Description

For background you should read PMID: 15039097. ChaI is a lectin (a sugar-binding protein) that binds to polysialic acid which is the outer shell composition of E. coli expressing the K1 capsule.

Notes

Part designed during Bio140L at UC Berkeley during Spring 2009

Source

Construction of {} basic part from pBca9145-Jtk2031
PCR ca998 and Odmd003R on pBca9145-Jtk2031 (510bp, EcoRI/BamHI)
Sub into pBca9495AK-Bca1144#5 (EcoRI/BamHI, 3171+910, L)
Product is pBca9495AK-M10051 {}
----------------------------
ca998 Forward Sequencing of pSB1A2/pSB1A3 gtatcacgaggcagaatttcag
Odmd003R Reverse Oligo for Chal Lectin w/o Stop Codon ccaaaGGATCCctcgctgtcgtcctctcgta

igem#sampleStatus Not in stock  
igem#status Unavailable  
synbiohub#ownedBy user/james  
synbiohub#ownedBy user/myers  
synbiohub#topLevel BBa_M10090/1