Types | DnaRegion
|
Roles | sequence_feature
Other
|
Sequences | BBa_M10090_sequence (Version 1)
|
Description
For background you should read PMID: 15039097. ChaI is a lectin (a sugar-binding protein) that binds to polysialic acid which is the outer shell composition of E. coli expressing the K1 capsule.
Notes
Part designed during Bio140L at UC Berkeley during Spring 2009
Source
Construction of {} basic part from pBca9145-Jtk2031
PCR ca998 and Odmd003R on pBca9145-Jtk2031 (510bp, EcoRI/BamHI)
Sub into pBca9495AK-Bca1144#5 (EcoRI/BamHI, 3171+910, L)
Product is pBca9495AK-M10051 {}
----------------------------
ca998 Forward Sequencing of pSB1A2/pSB1A3 gtatcacgaggcagaatttcag
Odmd003R Reverse Oligo for Chal Lectin w/o Stop Codon ccaaaGGATCCctcgctgtcgtcctctcgta