Source:
Generated By: https://synbiohub.org/public/igem/igem2sbol/1
Created by: Nicholas Elder
Date created: 2015-11-09 12:00:00
Date modified: 2015-11-10 01:21:57
tCloneTetRed with scrambled riboswitch
| Types | DnaRegion |
| Roles | CDS Coding |
| Sequences | BBa_J100239_sequence (Version 1) |
Description
This is based on the tConeTetRed insert (part BBa_J119386). The insert had the P2 promoter and GFP gene removed by digestion with BsaI and has had a scrambled sequence of a known riboswitch ligated in its place. This was used to test the effectiveness of tConeTetRed without the presence of a riboswitch, but with the added genetic distance of a functional riboswitch between the promoter and RBS. This was tested in JM109 E. coli cells and produces measurable fluorescence when grown in the presence of Tetracycline (20 ug/mL).Notes
When tCloneTetRed is used to test riboswitches, there are approximately 80 bases added between the promoter and ribosome binding site. To test the efficiency of the system with the increased distance between the promoter and RBS, we synthesized this scrambled riboswitch sequence to insert into the part to test the activity of the system without the regulatory capabilities.Source
The part J119386 comes from J119361 tCloneRed and J119140 TetA. The linker sequence was developed from K598018 tetA+GFP fused protein by Qingyang XIAO.The scrambled riboswitch sequence is 5' TATTGAGCGCGCTCCCGCCCTAATCCTGTTAGTTCAAGTGGGAGGAGTGGCCCAGTCACACTAGTTAATCCTAGGA.
| Sequence Annotation | Location | Component / Role(s) |
| P5 promoter Scrambled riboswitch TetA protein half Linker Sequence RFP protein half BD18 C Dog RBS | 1,37 41,117 206,1400 1401,1448 1449,2128 119,205 | promoter feature/promoter sequence_feature feature/misc feature/cds CDS sequence_feature feature/misc feature/cds CDS feature/misc sequence_feature |