Source:
Generated By: https://synbiohub.org/public/igem/igem2sbol/1
Created by: Ann Lesnefsky
Date created: 2009-10-18 11:00:00
Date modified: 2015-05-08 01:11:44
Pr XylR
| Types | DnaRegion |
| Roles | Device engineered_region |
| Sequences | BBa_K270001_sequence (Version 1) |
Description
Pr XylR is found in Pseudomonas putida mt-2 on the pWW0-TOL plasmid which contains the metabolic pathway for degrading toluene. The regulation for the degration of toluene on this plasmid is shown in the figure below.[[Image:Toluene_degradation_topology.jpg|950px]]
The image is adapted from Burlage, R. S., S. W. Hooper, and G. S. Sayler. 1989. The TOL (pWWO) catabolic plasmid. Appl. Environ. Microbiol. 55: 1323-1328.
Toluene is degraded through two pathways: the upper and lower, meta-pathway. The upper pathway degrades toluene into catechol and the lower pathway degrades catechol into pyruvate and acetaldehyde.
Pr is a constituative promoter that expresses the XylR regulator protien. When there is no toluene, XylR represses the Pr promoter and when there is toluene, XylR makes a complex with toluene that activates the Pu promoter expressing the upper pathway for toluene degradation. The XylR-toluene complex also relulates Ps and XylS, the regulatory promoter and protien for the lower pathway.
This part is necessary for the regulation of the Pu promoter in species other then P. putida mt-2. We created this part to test Bba_XXXXXX, Pu GFP, in E. coli.
This part can only be digested with EcoRI and SpeI to insert the part in front of the desired part because the XylR gene contains a PstI cutsite.
Notes
From the Pseudomonas putida plasmid pWW0 NCBI sequence, an upper primer (5??? TATACTAGTCTGGGGCGAGAGGCGACGAC 3???)with an SpeI cutsite and a lower primer (5??? GGGGAATTCTAGAATGTGGGCTGCTTGGTG 3???) with EcoRI and XbaI cutsites were designed to amplify the 41246-43507bp region.Source
NCBI: Pseudomonas putida plasmid pWW0| Access | Instance | Definition |
| public public | BBa_K270006 BBa_K270005 | BBa_K270006 BBa_K270005 |
| Sequence Annotation | Location | Component / Role(s) |
| BBa_K270006 BBa_K270005 | 1,421 422,2313 | BBa_K270006 BBa_K270005 |