Source:
Generated By: https://synbiohub.org/public/igem/igem2sbol/1
Created by: Shoujie Sun
Date created: 2014-10-02 11:00:00
Date modified: 2015-05-08 01:10:03
Curli Fiber generator under Pbad induction with positive regulation
| Types | DnaRegion |
| Roles | Composite engineered_region |
| Sequences | BBa_K1361000_sequence (Version 1) |
Description
We assembled this part in order to examine the concept that change of cell motility by control of CheZ chemotaxis regulator could disturb pre-expressed curli fiber structure. If the inducer occurs, in this case_acacia, CsgB protein will secrete into extracellular and act as nucleator to recruit soluble CsgA monomer into amyloid fibres, and the transcription of CheZ will be downgrade via cI-Plamda NOT gate. If induction condition disappears at a certain point, suppression of CheZ will be discharged. As the result, cells will be more moveable thus disturb or inhibit the establishment of curli structure. And in our final device, the modified CsgA that has ability to absorb nanogold, thus the dynamic detection could achieve by monitoring current change between two electrodes in the culture.Notes
The PstI loci within CsgA sequence has been replaced from CTGCAG to CTGCCG. And for nano gold absorbability, 6xLinker+2xCys(GGCAGCGGTGGCAGCGGTGGCGGT TGTTGC) and LPFFD(CTGCCGTTCTTTGAT) were added at the C-treminal of CsgA protein respectively. CsgA with7xhis tag at C-treminal were also used for Au-NTA-Ni absorbing.Source
CsgAC,CsgB collected by PCR from genome of E coli DH5alpha respectively. Other genes are collected from Biobricks Attribution Kit.| Access | Instance | Definition |
| public public public public public public public public public | BBa_K206000 BBa_S0103 BBa_K1361997 BBa_B0015 BBa_K880005 BBa_K1361998 BBa_R0051 BBa_B0034 BBa_K629003 | pBAD BBa_S0103 BBa_K1361997 BBa_B0015 BBa_K880005 BBa_K1361998 cI lam BBa_B0034 cheZ |